International Journal of Biological Sciences
Unofficial Impact Factor

News feeds of IJBS published articles

Manuscript Login Feedback

Google

Fish Stem Cells and Nuclear Transfer

International Journal of Medical Sciences

Journal of Cancer

Back | PDF

Int J Biol Sci 2007; 3:85-90 ©Ivyspring International Publisher

Research Paper

A complete mitochondrial genome sequence of Asian black bear Sichuan subspecies (Ursus thibetanus mupinensis)

Wan-ru Hou1, Yu Chen1, Xia Wu1, Jin-chu Hu1, Zheng-song Peng1, Jung Yang1, Zong-xiang Tang2, Cai-Quan Zhou1, Yu-ming Li3, Shi-kui Yang4, Yu-jie Du1, Ling-lu Kong4, Zheng-long Ren2, Huai-yu Zhang2, Su-rong Shuai2 Corresponding address

1. College of Life Science, China West Normal University, Nanchong 637002, China
2. Sichuan Agricultural University, Yaan 625014, China
3. Nanchong Agricultural Science Research Institute, Nanchong 637000, China
4. Sichuan Province Traditional Chinese Medicinal Materials Company Dujiangyan Raising Deer Field, Dujiangyan 611800, China

How to cite this article:
Hou Wr, Chen Y, Wu X, Hu Jc, Peng Zs, Yang J, Tang Zx, Zhou CQ, Li Ym, Yang Sk, Du Yj, Kong Ll, Ren Zl, Zhang Hy, Shuai Sr. A complete mitochondrial genome sequence of Asian black bear Sichuan subspecies (Ursus thibetanus mupinensis). Int J Biol Sci 2007; 3:85-90. Available from http://www.biolsci.org/v03p0085.htm

Abstract

We obtained the complete mitochondrial genome of U.thibetanus mupinensis by DNA sequencing based on the PCR fragments of 18 primers we designed. The results indicate that the mtDNA is 16 868 bp in size, encodes 13 protein genes, 22 tRNA genes, and 2 rRNA genes, with an overall H-strand base composition of 31.2% A, 25.4% C, 15.5% G and 27.9% T. The sequence of the control region (CR) located between tRNA-Pro and tRNA-Phe is 1422 bp in size, consists of 8.43% of the whole genome, GC content is 51.9% and has a 6bp tandem repeat and two 10bp tandem repeats identified by using the Tandem Repeats Finder. U. thibetanus mupinensis mitochondrial genome shares high similarity with those of three other Ursidae: U. americanus (91.46%), U. arctos (89.25%) and U. maritimus (87.66%).

Keywords: Ursus thibetanus mupinensis, mitochondrial genomes, sequencing, sequence analysis

1. Introduction

Mitochondria are vital subcellular organelles, responsible for the oxidizing reaction of the tricarboxylic acid cycle, the electron transfer and the energy metabolism in cells and have an independent genetic material called the mitochondria genome (mtDNA). Mammalian mtGenomes exist as closed circular strands and have a set of 13 protein-coding genes (NADH-ubiquinone oxidoreductase chain 1, 2, 3, 4L, 4, 5, 6, cytochrome c oxidase subunit 1, 2 and 3, ATP synthase F0 subunit 8 and ATP synthase F0 subunit 8), two rRNA genes (12s RNA and 16s RNA), and a full set of 22 tRNAgenes. The two strands that make up the genome are commonly known as the heavy strand (H-strand) and the light strand (L-strand) because of molecular weight differences as a result of different base compositions. Of the 13 protein-coding genes, 12 are on the H-strand and only one is on the L-strand. Noncoding regions are mainly limited to areas called the D-loop, thought to have functional roles in replication and transcription, and origin of replication of the L-strand (OL, thought to have a functional role in replication) [1]. The gene order is also highly conserved among most vertebrates [2]. During the last decades, mitochondrial genome sequence and gene arrangement comparisons were employed as powerful new tools for resolving ancient phylogenetic relationships [3, 4-8].

The black bear (Ursus thibetanus mupinensis) is listed in “The Convention on International Trade in Endangered Species of Wild Fauna and Flora “(CITES) the appendix I species, the national 2 levels of key protections wild animals and “China Red Data Book of Endangered Animals” V species [9]. There have been researches for mitochondria genome of Ursidae. Delisle and Strobeck obtained mitochondrial genome sequences of the Americas black bear (Ursus americanus), polar bear (Ursus maritimus) and brown bear (Ursus arctos) in 2002 [10]. Despite some studies of Asian black bear mitochondria individual genes such as the Cytb gene, there are no reports about the mitochondrial genome of the black bear, which live within the boundaries of Sichuan. In the current study, we report the complete mitochondrial genome sequence from a single Asian black bear Sichuan subspecies Ursus thibetanus mupinensis.

2. Materials and Methods

Skeletal muscle tissue samples of the Asian black bear Sichuan subspecies (Ursus thibetanus mupinensis) were obtained from black bears collected from Sichuan Province Traditional Chinese Medicinal Materials Company Dujiangyan Raising Deer Field.

DNA Extraction

Tissue sample was preserved in 70% ethanol until analysis. Total DNA was extracted from approximately 3×3×3 mm of the tissue using the conventional proteinase K/phenol/chloroform method [11] with some modifications as described by Masuda and Yoshida [12].

Primers Design, Polymerase Chain Reaction, Cloning of PCR Products and Sequencing

A series of primers were designed (Table 1), based on conserved regions identified from an alignment of published complete mitochondrial genomes from carnivores by Primer Premier 5.0: Ursus americanus (American black bear) (GenBank accession No. AF303109), Ursus maritimus (polar bear) (GenBank accession No. AF303111) and Ursus arctos (brown bear) (GenBank accession No. AF303110) [10]. PCR was using rTaq DNA polymerase (TAKARA) with 1–10μl DNA extracts in a total volume of 50μl.

According to PCR reaction condition exists difference because G, C and A, T basis Content and the base number of primers is different, we lead primers to be divided into 4 sets, the reaction condition of the same of set consistent. And established temperature steps a degree circulation in each set. It set circumstance with the reaction condition for corresponding describe respectively in table 2.

 Table 1 

Primers designed with Primer Premier 5.0 for amplifying the complete mitochondrial genome of U.thibetanus mupinensis

No.Forward PrimerReverse PrimerProduct length (bp)Forward Primer Sequence (5'-3')Reverse Primer Sequence (5'-3')
11-251072-10951095GATCACACATAACTGTGGTGTCATGCGGAGACTTACATGTGTAATCTTG
21036-10593622-36462611TAAAGGTTTGGTCCTAGCCTTCCCAAGCCCTGTCTCTTGGGCAGTATTG
32857-28823824-3849993AGATTAAAAGAAGTAAAAGGAACTCGGGCCCTACAATGTTTGGTCCTTTACG
43725-37524657-4681957ATGTTTATAATTAACACTATCTCACTAGTTATATTTGGGGGGGAATGCTTGCT
54181-42055207-52301050GTCCTACTAATGAATGGCTCATTCGCAGAAGTGGAAGGGGGATAGGCCG
64852-48785928-59531101ATACCCCGAAAATGTTGGTTTATCCCCGGTCTTTTTAGCCTAAATCTCTAGTC
75560-55836487-6514955CCACAACAACACTATCACTGTCCCGATTATCACGAATGCATGGGCAGTTACG
86286-63107834-78541568CAGTCTAGTGCTTTTATCAGCCATTAGTATAACGTAAGCGGGTTCT
97202-72248188-82091008GGTATAGATGTCGACACACGAGCGCCGGCAAGATGGTTCATACCG
107958-79818728-8748791CTTTGTCAGGGTTAAATTATAGGTGGAGAAGTCTGCATTCTCAGT
118671-86949588-9612942CCTCAATACTATAAAATCATTGAGGTTTGGTGAGTCATTAGGTGTTATC
129588-961010434-10457870GATAACACCTAATGACTCACCAAGTTGATTGTTTCTTTCTGGATTAC
1310405-1042711150-11178774CAATTGACTTCCAATCAATTAGCATTTTTAGCATTGTAAGAG
1411147-1117212522-125481402AATCTCTTACAATGCTAAAAATTATCAAACTATATTTACAGTAAATGGGCCCC
1512196-1221512947-12971776GGTCTACAAACACTCCTTCCAGCTTAGAGTTAGCTTTAGGGTTTG
1612703-1272215134-151582456CAAAAAATTGGTGCAACTCCGTTTTTCGGATGTTGGTCATTAAGG
1715139-1516116261-162781140ATGACCAACATCCGAAAAACCCATCTTCATTTTGAGAGGTT
1816194-16215158-183858GCTAGCCTCCATCCTCTACTTCCCCGTAACCATTGACTGAATAGCCCC
 Table 2 

Reaction condition of PCR for 18 pairs primerse (Group 1 primers to have: 2, 5, 7, 9, 18; Group 2 primers to have: 1, 3, 4, 6, 8, 10,12,15; Group 3 primers to have: 11,14,16; Group 4 primers to have: 13,17)

Reaction conditionGroup 1Group 2Group 3Group 4
Denaturation temperature94℃94℃94℃94℃
Time5min5min5min5min
Cycleindex1111
Denaturation temperature94℃94℃94℃94℃
Time30s30s30s30s
Annealing temperature60-50℃58-48℃55-46℃49-40℃
Time30s30s30s30s
Primer extension temperature72℃72℃72℃72℃
Time90s90s90s90s
Cycleindex for each annealing temperature2222
Denaturation temperature94℃94℃94℃94℃
Time30s30s30s30s
Annealing temperature55℃52℃49℃45℃
Time30s30s30s30s
Primer extension temperature72℃72℃72℃72℃
Time90s90s90s90s
Cycleindex30303030
Preservation temperature4℃4℃4℃4℃

The PCR products were fractionated on 1.5% (W/V) agarose gel, and selected bands were purified using a gel extraction kit (Sangon, Shanghai, China). The purified PCR products were ligated into the pMD18-T vector (TakaRa) and transformed into JM109 competent cells. Bacteria were grown in LB-ampicillin agar. Cloned PCR products were sequenced by BGI Life Tech Co., Ltd.

Sequence Analysis

The gene sequences of U. thibetanus mupinensis mitochondrial genome were identified by sequence comparison with published Carnivora gene sequences and similarity analysis using DNASTAR. Start and stop codons were used to help defining the sequences of protein coding genes. Percentage of GC base component and Base skew overall were calculated to analyze the genome characters. Tandem repeat was found by Tandem Repeats Finder [13].

3. Results and Discussion

General features of U.thibetanus mupinensis mitochondrial genome

The complete mtDNA sequence has been determined for U. thibetanus mupinensis mtDNA (GenBank accession no. DQ402478). The mtDNA is 16 868 bp in size, shorter than those of U. maritimus and U. arctos, which are 17017bp and 17020bp in length, yet longer than that of U. americanus which is 16841bp in length. The size differences result from different lengths of the control region among these species. It encodes 13 protein genes, 22 tRNA genes, and 2 rRNA genes (Fig 1). Eight tRNA genes and one protein gene are located on the light strand. The overall base composition of U. thibetanus mupinensis mtDNA for the H-strand is: A, 31.2%; C, 25.4%; G, 15.5%; T, 27.9%. Guanine (G) is the rarest nucleotide and GC content is 40.9%. Nucleotide composition analysis reveals that the U. thibetanus mupinensis genome is biased towards AT rich; such an AT content is lower than that of U. americanus and higher than those of U. maritimus and U. arctos. The gene content and gene order of U. thibetanus mupinensis mtDNA is typical for vertebrates [14]. With respect to the length of intergenic spacers and overlaps, U. thibetanus mupinensis has a rather compact genome similar to the other three Ursidae (Table 3 and Table 4). The U.thibetanus mupinensis mitochondrial genome shares high similarity with those of the other three Ursidae: U. americanus (91.46%), U. arctos (89.25%) and U. maritimus (87.66%).

Vertebrate animal mitochondrial genomes deviate from a random usage of nucleotide. Saccone et al. (1999) [14] used the formula, base-skew= (A-T/A+T) or (G-C/G+C), to evaluate the degree of the base bias, and found all the values of GC-skew were negative while all the values of AT-skew were positive in amniotes [14]. The base bias overall (GC=-0.242; AT=0.056) of the U.thibetanus mupinensis is most similar to that of U. arctos (GC=-0.238; AT=0.053) (Table 4).

 Table 3 

Components of U.thibetanus mupinensis Mitochondrial Genome

GeneNucleotide numberStart codonStop codonSize (bp)aaStrand1
Control region1-967967-
tRNA Phe968-103568H
12S rRNA1036-2000956H
tRNA Val2001-206666H
16S rRNA2067-36461580H
tRNA Leu3648-372275H
NADH13725-4681ATGTAA957318H
tRNA Ile4680-474970H
tRNA Gln4747-481973L
tRNA Met4821-488969H
NADH24890-5933ATATAG1044347H
tRNA Trp5932-599869H
tRNA Ala6007-607569L
tRNA Asn6076-614873L
Origin of L-strand replication6149-618135-
tRNA Cys6182-624867L
tRNA Tyr6248-631568L
COXI6317-7861ATGTAA1545514H
tRNA Ser7858-792972L
tRNA Asp7934-800067H
COXII8001-8684ATGTAA684227H
tRNA Lys8688-875568H
ATPase88758-8961ATGTAA20467H
ATPase68919-9599ATGTAA681226H
COXIII9599-10382ATGTaa784260H
tRNA Gly10383-1045169H
NADH310452-10798ATCTAa347115H
tRNA Arg10799-1086769H
NADH4L10868-11164ATGTAA29798H
NADH411158-12535ATGTaa1378458H
tRNA His12536-1260469H
tRNA Ser12605-1266359H
tRNA Leu12664-1273370H
NADH512734-14562ATTTAa1829609H
NADH614538-15065ATGTAA528175L
tRNA Glu15066-1513469L
Cytochrome b15139-16278ATGAGA1140379H
tRNA Thr16279-1634870H
tRNA Pro16349-1641365L
Control region16414-16868455-

1 H=heavy strand;L=light strand

 Figure 1 

The structure and annotation of the Ursus thibetanas mupinensis mitochondrial genome. (16S: 16S ribosomal RNA gene; 12S: 12S ribosomal RNA gene; ND1: NADH dehydrogenase subunit 1 gene; ND2: NADH dehydrogenase subunit 2 gene; ND3: NADH dehydrogenase subunit 3 gene; ND4L: NADH dehydrogenase subunit 4L gene; ND4: NADH dehydrogenase subunit 4 gene; ND5: NADH dehydrogenase subunit 5 gene; ND6: NADH dehydrogenase subunit 6 gene; COX1: Cytochrome c oxidase subunit 1 gene; COX2: Cytochrome c oxidase subunit 2 gene; COX3: Cytochrome c oxidase subunit 3 gene; ATP8: ATP synthase F0 subunit 8 gene; ATP6: ATP synthase F0 subunit 6 gene; Cyt B: Cytochrome b gene; Phe: Phenylalanine tRNA gene; Val: Valine tRNA gene; Leu: Leucine tRNA gene; Ile:Isoleucine tRNA gene; Gln: Glutamine tRNA gene; Met: Trp: Tryptophan tRNA gene; Ala: Alanine tRNA gene; Tyr: Tyrosine tRNA gene; Ser: Serine tRNA gene; Asn: Asparagine tRNA gene; Cys: Cysteine tRNA gene; Asp: Aspartic acid tRNA gene; Lys: Lysine tRNA gene; Gly: Glycin tRNA gene; Arg: Arginine tRNA gene; His: Histidine tRNA gene; Glu: Glutamic acid tRNA gene; Thr: Threonine tRNA gene; Pro: Proline tRNA gene)

Int J Biol Sci Image (Click on the image to enlarge.)

Protein coding genes

The mtDNA encodes 13 protein genes. Eight tRNA genes and one protein gene are located on the light strand [3]. We found the direction or the encoding-strand selection of the genes of U.thibetanus mupinensis is identical to the typical vertebrates (Table 3). Among 13 protein genes of U.thibetanus mupinensis, ten use ATG as start codon; NADH2, NADH3 and NADH5 use ATA, ATC and ATT as start codon, respectively. Some of these 13 protein genes are terminated with incomplete stop codons: NADH5 and NADH3 are terminated with TA; COXIII (cytochrome c oxidase subunit III) and NADH4 are terminated with T; the rest are terminated with TAA and AGA (Table 1). All these start codons and stop codons are almost the same with those of U. americanus, U. arctos and U. maritimus except that U. americanus, U. arctos and U. maritimus's ND5 use ATC as start codon, U. arctos and U. maritimus's ND4L use GTG as start codon and U. arctos and U. maritimus's ATP8 and COX2 are terminated with TAG. Presumably, these incomplete stop codons are accommodated post-transcriptionally in the mRNA maturation process, i.e. polyadenylation [15]. The 13 protein genes' nucleotide sequence and amino acid sequence of U.t. mupinensis mitochondrial genome shares high similarity with those of the other three Ursidae: U. americanus (88.7% to 93.7% and 80.6% to 100%), U. arctos (84.3% to 92.9% and 83.6% to 98.98%) and U. maritimus (84.8% to 93.4% and 82.1% to 98.98%) (Table 5).

 Table 4 

Comparisons of mitochondrial genome features in four Ursidae

Genome characterBlack bearAmerican black bearPolar bearBrown bear
GC base component40.9%40.6%41.3%41.3%
Base skew overallGC=-0.242 AT=0.056GC=-0.235 AT=0.048GC=-0.235 AT=0.053GC=-0.238 AT=0.053
 Table 5 

The 37 gene's similarity comparison at the nt and aa level from between U.thibetanus mupinensis mtDNA with Ursus Americanus, Ursus maritimus and Ursus arctos

GeneUrsus Americanus (American black bear)Ursus maritimus (polar bear)Ursus arctos (brown bear)
ntaantaantaa
tRNA Phe89.71%88.24%88.24%
12S rRNA95.85%95.45%95.13%
tRNA Val96.97%95.45%92.42%
16S rRNA96.01%94.75%95.25%
tRNA Leu97.33%100%100%
NADH192%97%90%97%90%97%
tRNA Ile98.57%98.57%98.57%
tRNA Gln97.26%97.26%97.26%
tRNA Met98.55%97.10%100%
NADH293%96%91%95%91%96%
tRNA Trp92.54%95.52%95.59%
tRNA Ala100%97.10%97.10%
tRNA Asn97.26%97.26%98.63%
tRNA Cys100%100%100%
tRNA Tyr100%92.65%95.59%
COXI92.4%97.5%90.7%97.7%90.3%96.9%
tRNA Ser94.44%97.22%97.22%
tRNA Asp100%100%100%
COXII93.7%98.2%89.2%96.5%89.0%96.0%
tRNA Lys95.59%100%98.53%%
ATPase888.7%80.6%84.3%83.6%84.8%82.1%
ATPase690.0%100%88.8%94.3%89.1%94.3%
COXIII91.2%98.1%92.9%98.9%93.4%98.5%
tRNA Gly91.30%89.86%91.30
NADH391%96%93%97%93%97%
tRNA Arg92.75%92.75%94.20%
NADH4L89%100%89%98.98%88%98.98%
NADH491%94%89%94%89%95%
tRNA His94.20%95.65%95.65%
tRNA Ser96.61%96.61%94.92%
tRNA Leu98.57%97.14%97.14%
NADH590%95%90%93%90%93%
NADH690%94%90%94%90%95%
tRNA Glu95.65%97.10%95.65%
Cytochrome b90.7%96.3%90.9%94.7%89.8%94.7%
tRNA Thr81.43%75.71%75.71%
tRNA Pro78.46%75.38%75.38%

RNA genes

There are 22 tRNA genes identified in the U. thibetanus mupinensis genome, with length ranges from 59 to 75 bp. The 12S rRNA and 16S rRNA genes are 965 bp and 1 580bp in length, respectively. These are typical for mammalian mitochondrial genomes [16-19]. The 24 RNA genes of U.t. mupinensis mitochondrial genome shares high similarity with those of the other three Ursidae: U. americanus (78.46% to 100%), U. arctos (75.38% to 100%) and U. maritimus (75.38% to 100%), too (Table 5).

Control region

The stem-and-1oop structure of origin for the putative light-strand replication of U.thibetanus mupinensis located between tRNA-Asn and tRNA-Cys, is 35bp in size, which is the same size and location detected in U. americanus, U. arctos and U. maritimus. The sequence of the control region (CR) of U. thibetanus mupinensis located between tRNA-Pro and tRNA-Phe is 1422 bp in size and consists of 8.43% of the whole genome. This percentage is slightly lower than that of U. maritimus (9.25%) and U. arctos (9.27%), and higher than that of U. americanus (8.28%). Its GC content is 51.9%, which is lower than U. americanus's (52.6%) and higher than U. maritimus's (48.6%) and U. arctos's (48.2%). By using the Tandem Repeats Finder [14], we have found a 6bp tandem repeat (ACGTGT) and two 10bp tandem repeats (ACGTGTACGT and TACGTGTACG). But U. maritimus and U. arctos contain two 10bp tandem repeats (U. maritimus and U. arctos have the same two 10bp tandem repeats which are CGTACGCATA and CGCACGTGTA) and no 6bp tandem repeat, while U. americanus contains a 6bp tandem repeat (ACGTGT) and no two 10bp tandem repeats. The sequence of control region of U.thibetanus mupinensis shares 90% identity with that of U. americanus, 71% with that of U. arctos, and 68% with that of U. maritimus.

Acknowledgements

This work is supported by the Key Chinese National Natural Science Foundation (30570275), Application Technology Project in Sichuan Province (2006J13-057), Key Scientific Research Foundation of Educational Committee of Sichuan Province (2004A101) and Key Discipline Construction Project in Sichuan Province (SZD0420).

Conflict of interest

The author has declared that no conflict of interest exists.

References

1. Shadel GS, Clayton DA. Mitochondrial DNA maintenance in vertebrates. Annu. Rev. Biochem. 1997 ;66:409-435

2. Boore JL. Animal mitochondrial genomes. Nucleic Acids Res. 1999 ;27(8):1767-1780

3. Boore JL. Complete mitochondrial genome sequence of Urechis caupo, a representative of the phylum Echiura. BMC Genomics. 2004 ;5(1):67

4. Zardoya R, Meyer A. Complete mitochondrial genome suggests diapsid affinities of turtles. Proc Natl Acad Sci USA. 1998 ;95(24):14226-14231

5. Janke A, Erpenbeck D, Nilsson M. et al. The mitochondrial genomes of the iguana (Iguana iguana) and the caiman (Caiman crocodylus): Implications for amniote phylogeny. Proc. R. Soc. Lond. B Biol. Sci. 2001 ;268(1467):623-631

6. Zhou KY. Molecular phylogenetics of amphibians and reptiles. Zoological Research. 2001 ;22(5):397-405

7. Joshua SR, Jennifer CA, Christopher CA. et al. Molecular systematics of primary reptilian lineages and the tuatara mitochondrial genome. Mol. Phylogenet. Evol. 2003 ;29(2):289-297

8. Wu XB, Wang YQ, Zhou KY. et al. The complete mitochondrial genome sequence of Chinese alligator and the phylogeny of crocodiles [J]. Chinese Science Bulletin. 2003 ;48(18):1954-1958

9. Wang S. China Red Data Book of Endangered Animals: Mammalia. Beijing: Science Press. 1998

10. Delisle I, Strobeck C. Conserved primers for rapid sequencing of the complete mitochondrial genome from carnivores, applied to three species of bears. Mol. Biol. Evol. 2002 ;19(3):357-361

11. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual 2nd edition. New York: Cold Spring Harbor Laboratory Press. 1989

12. Masuda R, Yoshida MC. A molecular phylogeny of the family Mustelidae (Mammalia, Carnivora), based on comparison of mitochondrial cytochrome b nucleotide sequences. Zool. Sci. 1994 ;11:605-612

13. Benson G. Tandem Repeats Finder: A program to analyze DNA sequences. Nucleic Acids Res. 1999 ;27:573-580

14. Saccone S, Giorgi CD, Gissi C. Evolutionary genomics in Metazoa: The mitochondrial DNA as a model system. Gene. 1999 ;238(1):195-209

15. Ojala D. et al. tRNA punctuation model of RNA processing in human mitochondria. Nature. 1981 ;290:470-474

16. Hiendleder S. et al. The complete mitochondrial DNA sequence of the domestic sheep (Ovis aries) and comparison with the other major ovine haplotype. J. Mol. Evol. 1998 ;47:441-448

17. Anderson S. et al. Sequence and organization of the human mitochondrial genome. Nature. 1981 ;290:457-465

18. Lin CS. et al. Complete nucleotide sequence of pig (Sus scrofa) mitochondrial genome and dating evolutionary divergence within Artiodactyla. Gene. 1999 ;236:107-114

19. Parma P. et al. The complete nucleotide sequence of goat (Capra hircus) mitochondrial genome. Goat mitochondrial genome. DNA Seq. 2003 ;14:199-20

Author contact

Corresponding address Correspondence to: Wan-ru Hou, College of Life Science, China West Normal University, 44# Yuying Road, 637002, Nanchong, China. Phone/Fax: +86-0817-2314311. E-mail: hwr168com.cn.


Received 2006-10-29
Accepted 2006-12-12
Published 2006-12-23